ZAP-70 expression as a marker for chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL/SLL)

Field

This disclosure relates to methods of diagnosis and detection of cancers, and more particularly to distinguishing types of CLL/SLL based on the level of ZAP-70 protein or nucleic acid in a biological sample

Background

Chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL) is a malignancy of B-lymphocytes in the blood, bone marrow, and lymph nodes with a characteristic immunophenotype. The recent WHO classification discusses CLL/SLL as an entity but notes that the term SLL is restricted to cases with the tissue morphology and immunophenotype of CLL, but which are non-leukemic (WHO Classification of Tumours. Tumours of Haemotopoietic and Lymphoid Tissue. Edited by Jaffe, Harris, Stein, Vardiman. IARC Press 2001). The clinical course of CLL is quite varied. While some patients have a chronic lymphocytosis without any need for therapeutic interventions, other patients may die rapidly despite aggressive treatment. The classic staging systems provide only limited prognostic information in newly diagnosed patients.

Recently, the presence or absence of somatic mutations in the immunoglobulin (Ig) variable region genes has been shown to distinguish between two disease subsets conferring important prognostic information. A median survival of 95 months was found in patients with unmutated Ig genes versus 293 months in patients with mutated Ig genes (Hamblin, Blood 94(6):1848-1854, 1999). Unfortunately, the ability to sequence Ig genes is not available in most clinical laboratories.

In addition to mutated Ig genes, several other potential diagnostic or prognostic markers have been identified for CLL, as well as for other small B-cell lymphomas. By way of example, these include CD10, CD20, CD21, CD23 (including serum CD23), CD38, CD69, CD43, FMC-7, and BCL-6. The research and medical communities are actively searching for good prognostic markers, but as yet no definitive markers have been identified.

Summary

This disclosure provides a method of detecting a biological condition associated with ZAP-70 overexpression in a subject. Also provided herein are methods to determine whether a subject has ZAP-70 nucleic acid or ZAP-70 protein overexpression. It is shown herein that the biological condition associated with ZAP-70 overexpression is Ig-unmutated CLL.

The disclosure also provides a method of modifying a level of expression of a ZAP-70 protein in a subject in order to reduce, ameliorate, or control CLL. Examples of these methods include expressing in the subject a recombinant genetic construct including a promoter operably linked to a nucleic acid molecule where expression of the nucleic acid molecule changes expression of the ZAP-70 protein. In one embodiment, the nucleic acid molecule includes at least 15 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 1. In another embodiment, the nucleic acid sequence includes a sequence at least 85% identical to SEQ ID NO: 1.

Also provided herein are kits for determining whether or not a subject has a biological condition associated with ZAP-70 overexpression. In one embodiment, the kit is an in vitro assay kit. These kits can be used to detect an overabundance of ZAP-70 protein or nucleic acid in a sample of tissue and/or body fluids from the subject. For example, the kits can include a container with an antibody specific for ZAP-70 protein and instructions for using the kit. The instructions can indicate the steps for performing a method to detect the presence of ZAP-70 protein or nucleic acid in the sample as well as how to analyze data generated by the method. In one embodiment, the instructions indicate that overabundance of ZAP-70 protein in the sample indicates that the individual has or is predisposed to a biological condition.

The foregoing and other features and advantages will become more apparent from the following detailed description of several embodiments, which proceeds with reference to the accompanying figures.

Brief description of the figures

FIGS. 1A and B is a series of schematic drawings showing the statistical methodology for the creation and validation of an Ig-mutational status predictor in CLL. FIG. 1A shows the performance of the predictor using a cross-validation strategy. FIG. 1B shows the performance of the Ig-mutational subtype predictor in a test set of six unmutated (*) and four mutated CLL (.DELTA.) samples.

FIG. 2 is a graph showing the predictive value of ZAP-70 mRNA and protein expression as surrogate markers of IgVH mutation status in CLL. ZAP-70 mRNA expression levels, as determined by DNA microarray analysis, predicted Ig-mutation status correctly in 95% of patients. ZAP-70 protein expression as determined by immunohistochemistry predicted Ig-mutation status correctly in 86% of patients.

FIGS. 3A and B is a series of graphs showing the impact of ZAP-70 mRNA and Ig-mutation status on the clinical course of CLL. Rate of disease progression is shown, as assessed by the treatment-free time interval measured in months from diagnosis for IgVH mutation status (FIG. 3A) and ZAP-70 mRNA expression (FIG. 3B).

FIG. 4 is a graph showing that quantitative RT-PCR could serve as a clinical test of ZAP-70 mRNA expression. Real time quantitative RT-PCR was performed in 9 CLL samples representing the ZAP-70 mRNA expression spectrum defined by the DNA microarray analysis. ZAP-70 expression is shown relative to the expression of beta-2-microglobulin in the same sample. The Pearson coefficient for correlation between the two methods was r=0.941.

FIGS. 5A and B is a series of digital images showing that ZAP-70 protein expression can distinguish CLL subtypes and could serve as a clinical test. In FIG. 5A, ZAP-70 protein expression was assessed by Western blotting in whole cell lysates of normal peripheral blood mononuclear cells (PBMC), or CD19+ purified leukemic cells from blood of patients with Ig-unmutated and Ig-mutated CLL. The data are representative of Western blot analysis of 20 patient samples analyzed. Equal loading is demonstrated by probing for beta-tubulin. In FIG. 5B, ZAP-70 can be detected by immunohistochemistry in clinical samples. PBMC (upper half) were embedded in a fibrin clot, fixed and processed by standard techniques. PBMC and routine bone marrow trephine biopsies (lower half) were stained with CD20 demonstrating involvement by B cell CLL (B-CLL), and CD3, which stains interspersed T-cells. ZAP-70 was positive in T cells and Ig-unmutated CLL cells.

Sequence listing

Informal

The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:

SEQ ID NO: 1 shows a cDNA encoding ZAP-70.

SEQ ID NO: 2 shows the amino acid sequence of ZAP-70.

SEQ ID NO: 3 shows the forward or upstream ZAP-70 oligonucleotide primer (5' TCTCCAAAGCACTGGGTG 3').

SEQ ID NO: 4 shows the reverse or downstream ZAP-70 oligonucleotide primer (5' AGCTGTGTGTGGAGACAACCAAG 3').

SEQ ID NO: 5 shows the forward or upstream VH1 and VH7 primer (5'-CCA TGG ACT GGA CCT GGA-3').

SEQ ID NO: 6 shows the forward or upstream VH2 primer (5'-ATG GAC ATA CTT TGT TCC AC-3').

SEQ ID NO: 7 shows the forward or upstream VH3 primer (5'-CCA TGG AGT TTG GGC TGA GC-3').

SEQ ID NO: 8 shows the forward or upstream VH4 primer (5'-ATG AAA CAC CTG TGG TTC TT-3').

SEQ ID NO: 9 shows the forward or upstream VH5 primer (5'-ATG GGG TCA ACC GCC ATC CT-3').

SEQ ID NO: 10 shows the forward or upstream VH6 primer (5'-ATG TCT GTC TCC TTC CTC AT-3').

SEQ ID NO: 11 shows a 3' oligonucleotide complementary to the JH consensus sequence (5'-ACC TGA GGA GAC GGT GAC C-3') as a reverse or downstream primer.

SEQ ID NO: 12 shows the constant region of the IgM locus (5'-AGG AGA AAG TGA TGG AGT CG-3') as a reverse or downstream primer.

SEQ ID NO: 13 shows the forward ZAP-70 primer.

SEQ ID NO: 14 shows the reverse ZAP-70 primer.

SEQ ID NO: 15 shows the ZAP-70 FAM.TM.-probe.

SEQ ID NO: 16 shows the framework region (FR)1-VH1 forward primer.

SEQ ID NO: 17 shows the framework region (FR)1-VH2 forward primer.

SEQ ID NO: 18 shows the framework region (FR)1-VH3 forward primer.

SEQ ID NO: 19 shows the framework region (FR)1-VH4 forward primer.

SEQ ID NO: 20 shows the framework region (FR)1-VH5 forward primer.

SEQ ID NO: 21 shows the framework region (FR)1-VH6 forward primer.

Detailed description

I. Abbreviations

TABLE-US-00001 BCR B cell receptor B-CLL B cell CLL CLL chronic lymphocytic leukemia DLBCL diffuse large B cell lymphoma FGFR fibroblast growth factor receptor H heavy IgV Ig variable region M-CLL IgV-mutated CLL PBMC peripheral blood mononuclear cells PKC protein kinase C RT-PCR reverse transcription polymerase chain reaction SLL small lymphocytic lymphoma TCR T cell antigen receptor UM-CLL IgV-unmutated CLL

II. Terms

Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

In order to facilitate review of the various embodiments of the invention, the following explanations of specific terms are provided:

Antisense, Sense, and Antigene: Double-stranded DNA (dsDNA) has two strands, a 5'.fwdarw.3' strand, referred to as the plus strand, and a 3'.fwdarw.5' strand (the reverse complement), referred to as the minus strand. Because RNA polymerase adds nucleic acids in a 5'.fwdarw.3' direction, the minus strand of the DNA serves as the template for the RNA during transcription. Thus, the RNA formed will have a sequence complementary to the minus strand and identical to the plus strand (except that U is substituted for T).

Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA. Sense molecules are molecules that are specifically hybridizable or specifically complementary to the minus strand of DNA. Antigene molecules are either antisense or sense molecules directed to a dsDNA target.

cDNA (complementary DNA): A piece of DNA lacking internal, non-coding segments (introns) and transcriptional regulatory sequences. cDNA may also contain untranslated regions (UTRs) that are responsible for translational control in the corresponding RNA molecule. cDNA is usually synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.

DNA (deoxyribonucleic acid): DNA is a long chain polymer which comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid (RNA)). The repeating units in DNA polymers are four different nucleotides, each of which comprises one of the four bases, adenine (A), guanine (G), cytosine (C), and thymine (T) bound to a deoxyribose sugar to which a phosphate group is attached. Triplets of nucleotides (referred to as codons) code for each amino acid in a polypeptide, or for a stop signal. The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.

Unless otherwise specified, any reference to a DNA molecule is intended to include the reverse complement of that DNA molecule. Except where single-strandedness is required by the text herein, DNA molecules, though written to depict only a single strand, encompass both strands of a double-stranded DNA molecule. Thus, a reference to the nucleic acid molecule that encodes a specific protein, or a fragment thereof, encompasses both the sense strand and its reverse complement. Thus, for instance, it is appropriate to generate probes or primers from the reverse complement sequence of the disclosed nucleic acid molecules.

Hybridization: Oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C. "Complementary" refers to the base pairing that occurs between to distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.

"Specifically hybridizable" and "specifically complementary" are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization.

Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na.sup.+ concentration) of the hybridization buffer will determine the stringency of hybridization, though waste times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, chapters 9 and 11, herein incorporated by reference.

For present purposes, "stringent conditions" encompass conditions under which hybridization will only occur if there is less than 25% mismatch between the hybridization molecule and the target sequence. "Stringent conditions" may be broken down into particular levels of stringency for more precise definition. Thus, as used herein, "moderate stringency" conditions are those under which molecules with more than 25% sequence mismatch will not hybridize; conditions of "medium stringency" are those under which molecules with more than 15% mismatch will not hybridize, and conditions of "high stringency" are those under which sequences with more than 10% mismatch will not hybridize. Conditions of "very high stringency" are those under which sequences with more than 6% mismatch will not hybridize.

In vitro amplification: Techniques that increases the number of copies of a nucleic acid molecule in a sample or specimen. An example of amplification is the polymerase chain reaction, in which a biological sample collected from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for the hybridization of the primers to nucleic acid template in the sample. The primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. The product of in vitro amplification may be characterized by electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing, using standard techniques. Other examples of in vitro amplification techniques include strand displacement amplification (see U.S. Pat. No. 5,744,311); transcription-free isothermal amplification (see U.S. Pat. No. 6,033,881); repair chain reaction amplification (see WO 90/01069); ligase chain reaction amplification (see EP-A-320 308); gap filling ligase chain reaction amplification (see U.S. Pat. No. 5,427,930); coupled ligase detection and PCR (see U.S. Pat. No. 6,027,889); and NASBA.TM. RNA transcription-free amplification (see U.S. Pat. No. 6,025,134).

Isolated: An "isolated" biological component (such as a nucleic acid molecule, protein, cell, or organelle) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extra-chromosomal DNA and RNA, proteins, and organelles. Nucleic acids and proteins that have been "isolated" include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.

Nucleotide: "Nucleotide" includes, but is not limited to, a monomer that includes a base linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof, or a base linked to an amino acid, as in a peptide nucleic acid (PNA). A nucleotide is one monomer in a polynucleotide. A nucleotide sequence refers to the sequence of bases in a polynucleotide.

Oligonucleotide: An oligonucleotide is a plurality of joined nucleotides joined by phosphodiester bonds, between about 6 and about 500 nucleotides in length. An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions. For example, oligonucleotide analogs can contain altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.

Particular oligonucleotides and oligonucleotide analogs can include linear sequences up to about 300 nucleotides in length, for example a sequence (such as DNA or RNA) that is at least 6 bases, for example at least 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100 or even 200 or more bases long, or from about 6 to about 50 bases, for example about 10-25 bases, such as 12, 15, 20, or 25 bases.

Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.

Open reading frame: A series of nucleotide triplets (codons) coding for amino acids without any internal termination codons. These sequences are usually translatable into a peptide.

Peptide Nucleic Acid (PNA): An oligonucleotide analog with a backbone comprised of monomers coupled by amide (peptide) bonds, such as amino acid monomers joined by peptide bonds.

Polymorphism: Variant in a sequence of a gene. Polymorphisms can be those variations (nucleotide sequence differences) that, while having a different nucleotide sequence, produce functionally equivalent gene products, such as those variations generally found between individuals, different ethnic groups, geographic locations. The term polymorphism also encompasses variations that produce gene products with altered function, i.e., variants in the gene sequence that lead to gene products that are not functionally equivalent. This term also encompasses variations that produce no gene product, an inactive gene product, or increased gene product. The term polymorphism may be used interchangeably with allele or mutation, unless context clearly dictates otherwise.

Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic of the nucleic acid molecule that is linked to the variation (e.g., an alteration of a secondary structure such as a stem-loop, or an alteration of the binding affinity of the nucleic acid for associated molecules, such as polymerases, RNases, and so forth).

Probes and primers: Nucleic acid probes and primers can be readily prepared based on the nucleic acid molecules provided as indicators of disease or disease progression. It is also appropriate to generate probes and primers based on fragments or portions of these nucleic acid molecules. Also appropriate are probes and primers specific for the reverse complement of these sequences, as well as probes and primers to 5' or 3' regions.

A probe comprises an isolated nucleic acid attached to a detectable label or other reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998).

Primers are short nucleic acid molecules, for instance DNA oligonucleotides 10 nucleotides or more in length. Longer DNA oligonucleotides may be about 15, 20, 25, 30 or 50 nucleotides or more in length. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then the primer extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other in vitro nucleic-acid amplification methods known in the art.

Methods for preparing and using nucleic acid probes and primers are described, for example, in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989), Ausubel et al. (ed.) (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998), and Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, Calif., 1990). Amplification primer pairs (for instance, for use with polymerase chain reaction amplification) can be derived from a known sequence such as the ZAP-70 sequences described herein, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).

One of ordinary skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, for example, a primer comprising 30 consecutive nucleotides of a ZAP-70 protein-encoding nucleotide will anneal to a target sequence, such as another homolog of the designated ZAP-70 protein, with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, in order to obtain greater specificity, probes and primers can be selected that comprise at least 20, 23, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of a ZAP-70 protein-encoding nucleotide sequences.

Also provided are isolated nucleic acid molecules that comprise specified lengths of the disclosed ZAP-70 nucleotide sequences. Such molecules may comprise at least 10, 15, 20, 23, 25, 30, 35, 40, 45 or 50 or more (e.g., at least 100, 150, 200, 250, 300 and so forth) consecutive nucleotides of these sequences or more. These molecules may be obtained from any region of the disclosed sequences (e.g., a ZAP-70 nucleic acid may be apportioned into halves or quarters based on sequence length, and isolated nucleic acid molecules may be derived from the first or second halves of the molecules, or any of the four quarters, etc.). A ZAP-70 cDNA or other encoding sequence also can be divided into smaller regions, e.g. about eighths, sixteenths, twentieths, fiftieths, and so forth, with similar effect.

Another mode of division is to select the 5' (upstream) and/or 3' (downstream) region associated with a ZAP-70 gene.

Protein: A biological molecule expressed by a gene or recombinant or synthetic coding sequence and comprised of amino acids.

Purified: The term "purified" does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified protein preparation is one in which the protein referred to is more pure than the protein in its natural environment within a cell or within a production/reaction chamber (as appropriate).

Recombinant: A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. A recombinant organism or cell is one that comprises at least one recombinant nucleic acid molecule.

Sequence identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs or orthologs of human ZAP-70 protein, and the corresponding cDNA or gene sequence, will possess a relatively high degree of sequence identity when aligned using standard methods. This homology will be more significant when the orthologous proteins or genes or cDNAs are derived from species that are more closely related (e.g., human and chimpanzee sequences), compared to species more distantly related (e.g., human and C. elegans sequences).

Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman Adv. Appl. Math. 2: 482, 1981; Needleman & Wunsch J. Mol. Biol. 48: 443, 1970; Pearson & Lipman Proc. Natl. Acad. Sci. USA 85: 2444, 1988; Higgins & Sharp Gene, 73: 237-244, 1988; Higgins & Sharp CABIOS 5: 151-153, 1989; Corpet et al. Nuc. Acids Res. 16, 10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al. Meth. Mol. Bio. 24, 307-31, 1994. Altschul et al. (J. Mol. Biol. 215:403-410, 1990), presents a detailed consideration of sequence alignment methods and homology calculations.

The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. J. Mol. Biol. 215:403-410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, Md.) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. By way of example, for comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment is performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties).

An alternative indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions. Stringent conditions are sequence-dependent and are different under different environmental parameters. Generally, stringent conditions are selected to be about 5.degree. C. to 20.degree. C. lower than the thermal melting point (T.sub.m) for the specific sequence at a defined ionic strength and pH. The T.sub.m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence remains hybridized to a perfectly matched probe or complementary strand. Conditions for nucleic acid hybridization and calculation of stringencies can be found in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Tijssen (Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes Part I, Chapter 2, Elsevier, New York, 1993). Nucleic acid molecules that hybridize under stringent conditions to a human ZAP-70 protein-encoding sequence will typically hybridize to a probe based on either an entire human ZAP-70 protein-encoding sequence or selected portions of the encoding sequence under wash conditions of 2.times.SSC at 50.degree. C.

Nucleic acid sequences that do not show a high degree of sequence identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein.

Small interfering RNAs: Synthetic or naturally-produced small double stranded RNAs (dsRNAs) that can induce gene-specific inhibition of expression in invertebrate and vertebrate species are provided. These RNAs are suitable for interference or inhibition of expression of a target gene and comprise double stranded RNAs of about 15 to about 40 nucleotides containing a 3' and/or 5' overhang on each strand having a length of 0- to about 5-nucleotides, wherein the sequence of the double stranded RNAs is essentially identical to a portion of a coding region of the target gene for which interference or inhibition of expression is desired. The double stranded RNAs can be formed from complementary ssRNAs or from a single stranded RNA that forms a hairpin or from expression from a DNA vector.

Specific binding agent: An agent that binds substantially only to a defined target. Thus a protein-specific binding agent binds substantially only the specified protein. By way of example, as used herein, the term "ZAP-70-protein specific binding agent" includes anti-ZAP-70 protein antibodies (and functional fragments thereof) and other agents (such as soluble receptors) that bind substantially only to the ZAP-70 protein.

Anti-ZAP-70 protein antibodies may be produced using standard procedures described in a number of texts, including Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). The determination that a particular agent binds substantially only to the specified protein may readily be made by using or adapting routine procedures. One suitable in vitro assay makes use of the Western blotting procedure (described in many standard texts, including Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988)). Western blotting may be used to determine that a given protein binding agent, such as an anti-ZAP-70 protein monoclonal antibody, binds substantially only to the ZAP-70 protein.

Shorter fragments of antibodies can also serve as specific binding agents. For instance, Fabs, Fvs, and single-chain Fvs (SCFvs) that bind to a specified protein would be specific binding agents. These antibody fragments are defined as follows:

Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain;

Fab', the fragment of an antibody molecule obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule;

(Fab')2, the fragment of the antibody obtained by treating whole antibody with the enzyme pepsin without subsequent reduction;

F(ab').sub.2, a dimer of two Fab' fragments held together by two disulfide bonds;

Fv, a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and

single chain antibody ("SCA"), a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule. Methods of making these fragments are routine.

Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.

Transformed: A transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration.

Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector may also include one or more selectable marker genes and other genetic elements known in the art.

Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Hence "comprising A or B" means include A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

III Overview of Several Embodiments

The inventors have discovered that ZAP-70 is expressed at high levels in the B-cells of CLL/SLL patients, and more particularly in the subset of CLL which tends to have a more aggressive clinical course that is especially in CLL/SLL patients with unmutated Ig genes. Because of the correlation between ZAP-70 expression levels and Ig gene mutation status, ZAP-70 can be used as a prognostic indicator to identify those patients likely to have severe disease (high ZAP-70, unmutated Ig genes), and who are therefore candidates for aggressive therapy.

Detecting ZAP-70 protein expression, for instance by Western blotting, immunohistochemistry, flow cytometry, or immunofluorescence, can serve as easily performed assays to distinguish the two groups of CLL patients. Further, ZAP-70 is useful as a target for therapeutic strategies, either directly or as an indicator of a type of CLL that responds to certain treatments.

In another embodiment, ZAP-70 RNA levels can be used similarly to ZAP-70 protein levels.

One embodiment is a method of detecting a biological condition associated with ZAP-70 overexpression in a subject, which method involves determining whether the subject has ZAP-70 nucleic acid or ZAP-70 protein overexpression, wherein the biological condition comprises Ig-unmutated CLL. Examples of this method are methods of predicting a predisposition to poor clinical outcome in a subject. Such methods involve determining whether the subject overexpresses ZAP-70 protein, wherein presence of ZAP-70 protein overexpression indicates the predisposition to poor clinical outcome.

Specific examples of the methods of detecting a biological condition associated with ZAP-70 involve reacting at least one ZAP-70 molecule contained in a sample (e.g., one containing a neoplastic cell) from the subject with a reagent comprising a ZAP-70-specific binding agent to form a ZAP-70:agent complex. In examples of these methods, the ZAP-70 molecule is a ZAP-70 encoding nucleic acid or a ZAP-70 protein. The ZAP-70 specific binding agent is, in some embodiments, a ZAP-70 oligonucleotide or a ZAP-70 protein specific binding agent.

In another embodiment, the method further involves in vitro amplifying a ZAP-70 nucleic acid prior to detecting the abnormal ZAP-70 nucleic acid. By way of example, the ZAP-70 nucleic acid is in vitro amplified using at least one oligonucleotide primer derived from a ZAP-70-protein encoding sequence. Examples of such oligonucleotide primers comprise at least 15 contiguous nucleotides from SEQ ID NO: 1.

Another embodiment is a method of detecting a biological condition associated with ZAP-70 overexpression in a subject, wherein the ZAP-70 molecule is a ZAP-70 encoding sequence. In such methods, the binding agent is optionally a labeled nucleotide probe. For instance, examples of such nucleotide probes have a sequence selected from the group consisting of: SEQ ID NO: 1; nucleic acid sequences having at least 85% sequence identity with SEQ ID NO: 1; and fragments thereof at least 15 nucleotides in length.

Another embodiment is a method of detecting a biological condition associated with ZAP-70 overexpression in a subject, wherein the ZAP-70 molecule is a ZAP-70 protein. In representative examples of such methods, the complexes are detected by Western blot assay, or by ELISA. By way of example, the ZAP-70 protein in such methods may include a sequence selected from the group consisting of: SEQ ID NO: 2; amino acid sequences having at least 85% sequence identity with SEQ ID NO: 2; and conservative variants thereof.

In a further embodiment is a method of treating a subject overexpressing ZAP-70, wherein the method involves administering to the subject a therapeutically effective amount of an agent that inhibits ZAP-70 function or expression. In specific examples, the agent inhibits ZAP-70 expression or ZAP-70 function. In other specific examples, the agent is an oligonucleotide that is homologous to a nucleic acid sequence as set forth as SEQ ID NO: 1. The agent can also be a kinase inhibitor or a drug that affects the ability of ZAP-70 to interact with other proteins. Such methods involve treating subjects for Ig-unmutated chronic lymphocytic leukemia associated with ZAP-70 overexpression.

In still further examples, the ZAP-70-specific binding agent is a ZAP-70-specific antibody (e.g., a monoclonal antibody) or a functional fragment thereof.

Also provided herein are kits for detecting overexpression of ZAP-70 protein in a subject (such as a mammal, for instance a human). Examples of such kits comprising a ZAP-70 protein specific binding agent, for instance a specific binding agent is capable of specifically binding to an epitope within the amino acid sequence shown in SEQ ID NO: 2; amino acid sequences that differ from those specified in SEQ ID NO: 2 by one or more conservative amino acid substitutions; amino acid sequences having at least 85% sequence identity to; or antigenic fragments of in of these.

Still further example kits include a means for detecting binding of the ZAP-70 protein binding agent to a ZAP-70 polypeptide.

The description continues in the full USPTO document.