Molecular probes for dna specific for the male genome of ruminants, especially of the subfamily of the bovines and particularly of the genus bos, the process for their preparationand the use of these probes for determining the sex of ruminant embryos and fetuses and for checking the presence of the y chromosome
CA 1312565 C · Owner: Kirszenbaum, Marek · Inventors: Cotinot, Corinne; Bishop, Colin; Kirszenbaum, Marek
Overview
Its claims, description and drawings are in the Canadian Patents Database.
Open the CIPO recordAbstract From the Canadian patent
A molecular probe is provided for DNA specific for the male genome of bovines of the genera Bos and Bison. The molecular probe comprises a nucleic acid segment of: (i) a DNA segment of 49 base pairs length having the following 5'-3' nucleotide sequence, being designated by the name b.c.1.2: 5' 3', ATCAGTGCAGGGACCGAGATGTGCTCCAAGGAGTGTTTATCGGCTGCTT; or (ii) a DNA segment containing at least 11 consecutive nucleotides of the sequence; or (iii) any nucleic acid segment having a sequence homologous or complementary to the sequence of the abovementioned DNA segments. That probe hybridizes, with a sequence being repeated at least 2000 times in the male genome of the genera Bos and Bison. The probe …
Read the whole patent
Listed from its CIPO record in Patent Yard's archive of Canadian patents past their term. Its claims, description and drawings are in the CIPO record and on Google Patents, and the Claude kit works from them.
Why it's free to use
- Granted January 12, 1993. A Canadian patent filed before October 1, 1989 lasted 17 years from grant, so its term ended January 12, 2010.
- We check Canadian rights only. A patent in its family in another country could still be in force: check its family on Google Patents.
Timeline
Timeline From CIPO dates
Sources & verification
Official CIPO records
Everything on this page comes from the CIPO record linked above. Contains information licensed under the Open Government Licence – Canada.